Archer® VariantPlex® CFTR Kit

Comprehensive mutation profiling for cystic fibrosis

The Archer® VariantPlex® CFTR kit is a targeted next-generation sequencing (NGS) assay for comprehensive detection of known and unknown variants in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Independent, unidirectional primers amplify large genomic regions, enabling detection of select intronic variants and exonic mutations as well as large deletions that would otherwise be difficult to detect with opposing primer techniques. Bidirectional coverage reduces allele dropout, increasing your chances of capturing previously unknown variants. This fast and easy-to-use lyophilized workflow is practical and economical for resource-limited communities and is thus suitable for global, pan-ethnic CFTR mutation profiling.

Highlights

  • Detect large deletions and select intronic mutations with independent, unidirectional primers
  • Bidirectional coverage from independent unidirectional primers combats allelic dropout for higher-confidence mutation calling
  • Comprehensive variant detection through coding exons and select intronic variants, in addition to canonical hotspots, enables pan-ethnic CFTR coverage
  • Simple, lyophilized workflow is practical for both high- and low-throughput laboratories, enabling flexible batch size with zero reagent waste




Performance Specifications

50ng+

Input DNA required

<6 hours

Time required

2.5 hours

Hands-on time

1.38kb

Total target size

>99%

Bases covered

>99%

Unique molecule on-target

~93%

Coverage uniformity > 20% mean

Illumina®

Platform

150,000

Recommended # of reads per library

Genomic DNA from blood, saliva, buccal cells or DBS punch

Sample type



What is Cystic Fibrosis?

Cystic Fibrosis (CF) is an autosomal recessive disease that is characterized by the build up of thick mucus resulting in chronic lung infections and airway inflammation. Loss-of-function mutations in the CF transmembrane conductance regulator (CFTR) underlie CF, as CFTR has essential roles in chloride ion transport and the production of thin mucus. While there is no cure for CF, early diagnosis and treatment interventions are necessary to help prevent airway obstruction and lung infections (1). Therefore, carrier identification and newborn screening have significant implications in the overall prognosis of CF patients.



Ethnic differences in CFTR mutation profiles underlie CF detection disparity

CF is currently under-diagnosed in nonwhite populations compared to white populations (3). This ethnic disparity in CF diagnosis is primarily attributed to differences in underlying CFTR mutations, which were recently shown to vary significantly across ethnic groups by Iris Schrijver et al. (4). For example, the Phe508del variant is present in 90% of whites, 83% of Native Americans, 70% of Hispanics, 59% of Asians and 62% of African Americans among those diagnosed with CF (3). Current CFTR genotyping assays were designed based on the ACMG and ACOG-recommended 23-mutation panel, which was generated from mutation profiles obtained from white individuals in a study that pre-dates the identification of mutation differences across ethnic groups (1,2). In nonwhite populations, other novel point mutations, duplications and deletions in CFTR are more prevalent (3). Due to these differences in mutation profiles between ethnic populations, an unbiased approach to detect both known and unknown variants is key for pan-ethnic CF diagnosis. AMP technology provides superior coverage through the use of molecular barcoded adaptors (MBCs) and independent gene-specific primers (GSPs), enabling unbiased NGS-based detection of known and unknown mutations across larger regions of the CFTR gene.


VariantPlex CFTR enables NGS-based detection of large DNA deletions through breakpoint identification

The majority of mutations in the CFTR gene are base substitutions and deletions of varying sizes (1,5). The CFTRdele2,3(21kb) mutation, reported by Dörk et al. in 2000 results in loss of exons 2 and 3 in CFTR transcripts, producing a premature termination signal within exon 4. This severe deletion is more prevalent in Central and Eastern Europe and confers an aggressive phenotype. As shown in the figure below, the anchored primers used in AMP allow for amplification into large genomic regions from both ends independently, allowing Archer libraries to sequence both wildtype and deletion alleles using the same primers. We tested the ability of the VariantPlex CFTR kit and Archer Analysis DNA anomaly pipeline to detect CFTRdele2,3(21kb) in a pre-validated DNA sample obtained from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research: NA18668. Part (B) in the adjacent figure show the CFTRdele2,3(21kb) detected from this sample in the Archer Analysis DNA anomaly pipeline and sequence identification of the genomic breakpoint.




Dual, independent coverage reduces allele dropout


Allele dropout due to primers blocking SNVs can reduce confidence in mutation calling. AMP’s strand-specific priming, however, facilitates dual independent coverage across target regions to ensure that some reads are retained when one primer drops out, thus reducing the risk of false negative mutation detection due to ethnic genetic polymorphisms.




References/Resources

  1. J. Amos et al., Technical standards and guidelines for CFTR mutation testing. ACMG (2006).
  2. Committee Opinion No. 486: Update on Carrier Screening for Cystic Fibrosis. Obstetrics & Gynecology. 117, 1028–1031 (2011).
  3. Cystic Fibrosis Mutation Database. genet.sickkids.on.ca, (available at http://www.genet.sickkids.on.ca/cftr/app).
  4. I. Schrijver et al., The Spectrum of CFTR Variants in Nonwhite Cystic Fibrosis Patients: Implications for Molecular Diagnostic Testing. J Mol Diagn. 18, 39–50 (2016).
  5. "Cystic Fibrosis Foundation Patient Registry" (Bethesda, 2014), (available at https://www.cff.org/Our-Research/CF-Patient-Registry/).
  6. T. Dörk et al., Characterization of a novel 21-kb deletion, CFTRdele2,3(21 kb), in the CFTR gene: a cystic fibrosis mutation of Slavic origin common in Central and East Europe. Human Genetics. 106, 259–268 (2000).
  7. The Clinical and Functional Translation of CFTR (CFTR2); available at http://cftr2.org. Copyright © 2011 US CF Foundation, Johns Hopkins University, The Hospital for Sick Children.


CFTR variants detected using VariantPlex CFTR Kit for Illumina

Mutation (cDNA name)HGVS Amino acid change23ACMG260+ CFTR2
c.-9_14del23No protein name124del23bp
c.1A>Gp.Met1ValM1V
c.11C>Ap.Ser4XS4X
c.50delTp.Phe17SerfsX8182delT
c.53+1G>TNo protein name185+1G->T
c.79G>Tp.Gly27XG27X
c.91C>Tp.Arg31CysR31C
c.115C>Tp.Gln39XQ39X
c.137C>Ap.Ala46AspA46D
c.164+1G>ANo protein name296+1G->A
c.165-1G>ANo protein name297-1G->A
c.166G>Ap.Glu56LysE56K
c.170G>A or c.171G>Ap.Trp57XW57X
c.174_175insAp.Arg59LysfsX10306insA
c.178G>Tp.Glu60XE60X
c.200C>Tp.Pro67LeuP67L
c.220C>Tp.Arg74TrpR74W
c.223C>Tp.Arg75XR75X
c.224G>Ap.Arg75GlnR75Q
c.233dupTp.Trp79LeufsX32365-366insT
c.262_263delTTp.Leu88IlefsX22394delTT
c.273+1G>ANo protein name405+1G->A
c.273+3A>CNo protein name405+3A->C
c.274-1G>ANo protein name406-1G->A
c.274G>Ap.Glu92LysE92K
c.274G>Tp.Glu92XE92X
c.292C>Tp.Gln98XQ98X
c.310delAp.Arg104GlufsX3442delA
c.313delAp.Ile105SerfsX2444delA
c.325_327delTATinsGp.Tyr109GlyfsX4457TAT->G
c.328G>Cp.Asp110HisD110H
c.349C>Tp.Arg117CysR117C
c.350G>Ap.Arg117HisR117H
c.366T>Ap.Tyr122XY122X
c.409delCp.Leu137SerfsX16 541delC
c.442delAp.Ile148LeufsX5574delA
c.443T>Cp.Ile148ThrI148T
c.489+1G>TNo protein name621+1G->T
c.489+3A>GNo protein name621+3A->G
c.531delTp.Ile177MetfsX12 663delT
c.532G>Ap.Gly178ArgG178R
c.543_546delTAGTp.Leu183PhefsX5675del4
c.577G>Tp.Glu193XE193X
c.579+3A>GNo protein name711+3A->G
c.579+5G>ANo protein name711+5G->A
c.580-1G>TNo protein name712-1G->T
c.595C>Tp.His199TyrH199Y
c.613C>Tp.Pro205SerP205S
c.617T>Gp.Leu206TrpL206W
c.658C>Tp.Gln220XQ220X
c.680T>Gp.Leu227ArgL227R
c.720_741delAGGGAGAATGATGATGAAGTACp.Gly241GlufsX13852del22
c.803delAp.Asn268IlefsX17935delA
c.828C>Ap.Cys276XC276X
c.859_863delAACTTp.Asn287LysfsX19 991del5
c.948delTp.Phe316LeufsX121078delT
c.987delAp.Gly330GlufsX391119delA
c.988G>Tp.Gly330XG330X
c.1000C>Tp.Arg334TrpR334W
c.1006_1007insGp.Ile336SerfsX281138insG
c.1007T>Ap.Ile336LysI336K
c.1013C>Tp.Thr338IleT338I
c.1021T>Cp.Ser341ProS341P
c.1022_1023insTCp.Phe342HisfsX281154insTC
c.1029delCp.Cys343X1161delC
c.1040G>Ap.Arg347HisR347H
c.1040G>Cp.Arg347ProR347P
c.1055G>Ap.Arg352GlnR352Q
c.[1075C>A;1079C>A]p.[Gln359Lys;Thr360Lys]Q359K/T360K
c.1081delTp.Trp361GlyfsX81213delT
c.1116+1G>ANo protein name1248+1G->A
c.1117-1G>ANo protein name1249-1G->A
c.1127_1128insAp.Gln378AlafsX41259insA
c.1202G>A or c.1203G>Ap.Trp401XW401X
c.1209+1G>ANo protein name1341+1G->A
c.1240C>Tp.Gln414XQ414X
c.1329_1330insAGATp.Ile444ArgfsX31461ins4
c.1340delAp.Lys447ArgfsX21471delA
c.1364C>Ap.Ala455GluA455E
c.1365_1366delGGp.Val456CysfsX251497delGG
c.1393-1G>ANo protein name1525-1G->A
c.1393-2A>GNo protein name1525-2A->G
c.1397C>A or c.1397C>Gp.Ser466XS466X
c.1400T>Cp.Leu467ProL467P
c.1418delGp.Gly473GlufsX541548delG
c.1466C>Ap.Ser489XS489X
c.1475C>Tp.Ser492PheS492F
c.1477_1478delCAp.Gln493ValfsX101609delCA
c.1477C>Tp.Gln493XQ493X
c.1519_1521delATCp.Ile507delI507del
c.1521_1523delCTTp.Phe508delF508del
c.1545_1546delTAp.Tyr515X1677delTA
c.1558G>Tp.Val520PheV520F
c.1572C>Ap.Cys524XC524X
c.1573C>Tp.Gln525XQ525X
c.1585-1G>ANo protein name1717-1G->A
c.1624G>Tp.Gly542XG542X
c.1645A>C or c.1647T>Gp.Ser549ArgS549R
c.1646G>Ap.Ser549AsnS549N
c.1648G>Tp.Gly550XG550X
c.1650delAp.Gly551ValfsX81782delA
c.1651G>Ap.Gly551SerG551S
c.1652G>Ap.Gly551AspG551D
c.1654C>Tp.Gln552XQ552X
c.1657C>Tp.Arg553XR553X
c.1673T>Cp.Leu558SerL558S
c.1675G>Ap.Ala559ThrA559T
c.1679+1.6kbA>GNo protein name1811+1.6kbA->G
c.1679+1G>CNo protein name1811+1G->C
c.1679G>Ap.Arg560LysR560K
c.1679G>Cp.Arg560ThrR560T
c.1680-1G>ANo protein name1812-1G->A
c.1682C>Ap.Ala561GluA561E
c.1692delAp.Asp565MetfsX71824delA
c.1705T>Gp.Tyr569AspY569D
c.1727G>Cp.Gly576AlaG576A
c.1736A>Gp.Asp579GlyD579G
c.1753G>Tp.Glu585XE585X
c.1766+1G>ANo protein name1898+1G->A
c.1766+1G->CNo protein name1898+1G->C
c.1766+3A>GNo protein name1898+3A->G
c.1792_1798delAAAACTAp.Lys598GlyfsX111924del7
c.1841A>Gp.Asp614GlyD614G
c.1923_1931del9insAp.Ser641ArgfsX52055del9->A
c.1973_1985del13insAGAAAp.Arg658LysfsX42105-2117del13insAGAAA
c.1986_1989delAACTp.Thr663ArgfsX82118del4
c.2002C>Tp.Arg668CysR668C
c.2017G>Tp.Gly673XG673X
c.2051_2052delAAinsGp.Lys684SerfsX382183AA->G or 2183delAA->G
c.2052_2053insAp.Gln685ThrfsX42184insA
c.2052delAp.Lys684AsnfsX382184delA
c.2053_2054insCp.Gln685ProfsX842185insC
c.2053C>Tp.Gln685XQ685X
c.2125C>Tp.Arg709XR709X
c.2128A>Tp.Lys710XK710X
c.2175_2176insAp.Glu726ArgfsX42307insA
c.2195T>Gp.Leu732XL732X
c.2215delGp.Val739TyrfsX162347delG
c.2260G>Ap.Val754MetV754M
c.2290C>Tp.Arg764XR764X
c.2353C>Tp.Arg785XR785X
c.2374C>Tp.Arg792XR792X
c.2424_2425insATp.Ser809IlefsX13T2556insAT
c.2453delTp.Leu818TrpfsX32585delT
c.2462_2463delGTp.Ser821ArgfsX4T2594delGT
c.2464G>Tp.Glu822XE822X
c.2490+1G>ANo protein name2622+1G->A
c.2491G>Tp.Glu831XE831X
c.2537G>Ap.Trp846XW846X
c.2547C>Ap.Tyr849XY849X
c.2551C>Tp.Arg851XR851X
c.2583delTp.Phe861LeufsX32711delT
c.2589_2599delAATTTGGTGCTp.Ile864SerfsX282721del11
c.2600_2601insAp.Val868SerfsX282732insA
c.2620-26A>GNo protein name2752-26A->G
c.2657+2_2657+3insANo protein name2789+2insA
c.2657+5G>ANo protein name2789+5G->A
c.2658-1G>CNo protein name2790-1G->C
c.2735C>Ap.Ser912XS912X
c.2737_2738insG p.Tyr913X2869insG
c.2739T>Ap.Tyr913XY913X
c.2764_2765insAGp.Val922GlufsX22896insAG
c.2780T>Cp.Leu927ProL927P
c.2810_2811insTp.Val938GlyfsX372942insT
c.2825delTp.Ile942ThrfsX262957delT
c.2834C>Tp.Ser945LeuS945L
c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCCp.Leu953PhefsX112991del32
c.2875delGp.Ala959HisfsX93007delG
c.2896delAp.Thr966ArgfsX23028delA
c.2908G>Cp.Gly970ArgG970R
c.2930C>Tp.Ser977PheS977F
c.2988G>ANo protein name3120G->A
c.2988+1G>ANo protein name3120+1G->A
c.2989-1G>ANo protein name3121-1G->A
c.2989-2A>GNo protein name3121-2A->G
c.2991G>Cp.Leu997PheL997F
c.3002_3003delTGp.Val1001AspfsX453132delTG
c.3039delCp.Tyr1014ThrfsX9 3171delC
c.3080T>Cp.Ile1027ThrI1027T
c.3140-26A>GNo protein name3272-26A->G
c.3160C>Gp.His1054AspH1054D
c.3181G>Cp.Gly1061ArgG1061R
c.3194T>Cp.Leu1065ProL1065P
c.3196C>Tp.Arg1066CysR1066C
c.3197G>Ap.Arg1066HisR1066H
c.3205G>Ap.Gly1069ArgG1069R
c.3208C>Tp.Arg1070TrpR1070W
c.3209G>Ap.Arg1070GlnR1070Q
c.3222T>Ap.Phe1074LeuF1074L
c.3230T>Cp.Leu1077ProL1077P
c.3266G>Ap.Trp1089XW1089X
c.3276C>A or c.3276C>Gp.Tyr1092XY1092X
c.3293G>A or c.3294G>Ap.Trp1098XW1098X
c.3302T>Ap.Met1101LysM1101K
c.3304A>Tp.Arg1102XR1102X
c.3310G>Tp.Glu1104XE1104X
c.3368-2A>GNo protein name3500-2A->G
c.3454G>Cp.Asp1152HisD1152H
c.3472C>Tp.Arg1158XR1158X
c.3484C>Tp.Arg1162XR1162X
c.3485G>Tp.Arg1162LeuR1162L
c.3528delCp.Lys1177SerfsX153659delC
c.3535_3536insTCAAp.Thr1179IlefsX173667ins4
c.3587C>Gp.Ser1196XS1196X
c.3605delAp.Asp1202AlafsX93737delA
c.3611G>A or c.3612G>Ap.Trp1204XW1204X
c.3659delCp.Thr1220LysfsX83791delC
c.3691delTp.Ser1231ProfsX43821delT
c.3700A>Gp.Ile1234ValI1234V
c.3705T>Gp.Ser1235ArgS1235R
c.3717+12191C>TNo protein name3849+10kbC->T
c.3718-1G>ANo protein name3850-1G->A
c.3718-3T>GNo protein name3850-3T->G
c.3731G>Ap.Gly1244GluG1244E
c.3744delAp.Lys1250ArgfsX93876delA
c.3747delGp.Lys1250ArgfsX93878delG
c.3752G>Ap.Ser1251AsnS1251N
c.3761T>Gp.Leu1254XL1254X
c.3763T>Cp.Ser1255ProS1255P
c.3764C>Ap.Ser1255XS1255X
c.3773_3774insTp.Leu1258PhefsX73905insT
c.3808G>Ap.Asp1270AsnD1270N
c.3846G>Ap.Trp1282XW1282X
c.3873+1G>ANo protein name4005+1G->A
c.3882_3885delTATTp.Ile1295PhefsX324010del4
c.3883delAp.Ile1295PhefsX334015delA
c.3884_3885insTp.Ser1297PhefsX54016insT
c.3899dupTp.Ser1297PhefsX54021dupT
c.3908delAp.Asn1303ThrfsX254040delA
c.3909C>Gp.Asn1303LysN1303K
c.3937C>Tp.Gln1313XQ1313X
c.4046G>Ap.Gly1349AspG1349D
c.4077_4080delTGTTinsAANo protein name4209TGTT->AA
c.4086_4087insTp.Lys1363X4218insT
c.4111G>Tp.Glu1371XE1371X
c.4144C>Tp.Gln1382XQ1382X
c.4147_4148insAp.Ile1383AsnfsX34279insA
c.4196_4197delTCp.Cys1400X4326delTC
c.4231C>Tp.Gln1411XQ1411X
c.4234C>Tp.Gln1412XQ1412X
c.4251delAp.Glu1418ArgfsX144382delA
c.4296_4297insGAp.Ser1435GlyfsX144428insGA

Back to the top

How to contact us

Address

2477 55th Street, Suite 202

Boulder, CO 80301

Phone

Phone: (877) 771 1093

Phone: (303) 357 9001

All content © 2017 ArcherDX, Inc.

For Research Use Only. Not for use in diagnostic procedures. For Research Use Only. Not for use in diagnostic procedures.